Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBMS141

[Submit comment/correction]

Locus	GBMS141
Type	Microsatellite
Chromosome	5H 7H
Map	Barley-ConsensusFHB-7H 86.06 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT [ Show all 7 ]
Species	Hordeum vulgare
Probe	GBMS141
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	[ Hide all but 1 of 9 ] Number of populations contributing to the placement of GBMS141 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Polymorphic Information Content (PIC) = 0.79 Number of alleles = 4 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Steptoe x Morex, Igri x Franka Insert contains repeat (CA)16 Developing laboratory = IPK (M Roeder, M. Ganal)
Probe	GBMS141
Locus	GBMS0141 GBMS141
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remarks	Insert contains repeat (CA)16 Primer sequences for this SSR are proprietary. Those interested should contact Marion Roeder. Primer sequences for this SSR are proprietary, those interested should contact Marion Roeder
Type	PCR SSR
PCR primers	Forward ACGACAACATTTTGTTGCCA Reverse TGTGAATTTCTTGGACTTGGG
Source Species	Hordeum vulgare
Source Germplasm	Franka (barley)