Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM20

[Submit comment/correction]

Locus	HVM20
Type	Microsatellite
Synonym	Correct name HVM020
Chromosome	1H
Map	Barley-consensus-2003-1H 35.8 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_1H_4 MetaQ.HD_1H_1 QFhs.umn-1H QHD.umn-1H
Map Data	[ Hide all but 1 of 11 ] Barley consensus 2003 Barley, AxHs/QTL Barley, Cali-sib x BowmanBC, QTL Barley, Consensus 2006, DArT Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, HN x H602, Sato2009 Barley, Lx41 Barley, LxHs Oat, AxM Doubled Haploid, 2008
Species	Avena sativa Hordeum spontaneum Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM20 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. [ Show all 6 ]
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of HVM20 in the Barley, Consensus 2006 DArT maps = 2 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Developing laboratory = VPISU (MA Saghai Maroof)
Probe	HVM20
Locus	HVM20 HVM0020 HVM020
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (GA)19.
Type	PCR SSR Microsatellite
PCR primers	5' CTCCACGAATCTCTGCACAA 3' 5' CACCGCCTCCTCTTTCAC 3' CTCCACGAATCTCTGCACAA CACCGCCTCCTCTTTCAC
SSR size	0.151
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.