Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM22a

[Submit comment/correction]

Locus	HVM22a
Type	Microsatellite
Chromosome	6H
Map	Barley-ConsensusFHB-6H 59.43 Hordeum-Consensus2007-SSR-6H 62.14 Hv-Consensus2006-Marcel-6H 62.14 Hv-Integrated2009-6H 60.7 Hv-L94/Vada-2006-6H 60.75
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006
Species	Hordeum vulgare
Probe	HVM22
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : L94 x Vada, Igri x Franka Insert contains repeat (AC)13 Developing laboratory = VPISU (MA Saghai Maroof)
Probe for Locus	HVM22
Locus	HVM22 HVM022 HVM22b HVM22a
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
General Remarks	Insert contains repeat (AC)13.
Type	PCR SSR
PCR primers	5' TTTTGGGGGATGCCTACATA 3' 5' TTTCAAATGGTTGGATTGGA 3' TTTTGGGGGATGCCTACATA TTTCAAATGGTTGGATTGGA
SSR size	0.167
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.