Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM33

[Submit comment/correction]

Locus	HVM33
Type	Microsatellite
Synonym	Correct name HVM033 Synonym HVM33
Chromosome	3H
Chromosome Arm	3HL
Map	Barley-consensus-2003-3H 56.7 [ Show all 16 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 16 ] Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxHs/QTL Barley, Cali-sib x BowmanBC, QTL Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, HN x H602, Sato2009 Barley, Integrated, Marcel 2009 Barley, Lina x H.spont, SNP Barley, Lx41 Barley, LxHs Barley, Nure x Tremois Barley, Steptoe x Morex, SNP
Species	Hordeum spontaneum Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM33 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of HVM33 in the Barley, Consensus 2006 DArT maps = 3 [ Show all 7 ]
Probe	HVM33
Locus	HVM33 HVM0033 HVM033
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (CA)7.
Type	PCR SSR
PCR primers	5' ATATTAAAAAAGGTGGAAAGCC 3' 5' CACGCCCTCTCCCTAGAT 3' ATATTAAAAAAGGTGGAAAGCC CACGCCCTCTCCCTAGAT
SSR size	0.157
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.