Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWA402

Locus	IWA402
Type	SNP
Synonym	Other name BS00180133 wsnp_BE637808A_Ta_2_1 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	4A
Map	[ Hide all but 1 of 12 ] Durum Wheat, NSGC Lr 4A 63.8 Wheat, 2013 9K Consensus 4A 137.29 Wheat, Finch x Eltan 4A 69.2 Wheat, Yr genes and QTL 4A 34.5 Wheat_2014_90KSNP_4A 51.1522 Wheat_2014_i9K_Ug99_PIxLMPG_4A 41 Wheat_AB, Ben x PI41025 4A 24.9 Wheat_AB, Mohawk x Cocorit69 4A_2 13.6 Wheat_AB, Simeto x Levante 4A_2 0 Wheat_AB, Svevo x Zavitan 4A 65.7 Wheat_AB_2015_Consensus-4A 63.8 Wheat_Yr_2021-4A 73.84
	[ Show Nearby Loci ]
QTL with Locus Marker	PRL-Svevo2.M_2075-4A Qfhb.nc-4A QPrl.UniboDP-4A.1
Map Data	Durum Wheat, NSGC Lr [ Show all 12 ]
Species	Triticum aestivum
Probe	IWA402_KASP wsnp_BE637808A_Ta_2_1
Reference	Petersen S et al. (2016) Mapping of Fusarium Head Blight Resistance Quantitative Trait Loci in Winter Wheat Cultivar NC-Neuse Crop Science 56:1473-1483. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. Cavanagh CR et al. (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars Proceedings of the National Academy of Sciences, USA 110:8057-8062.
Probe for Locus	IWA402_KASP
Locus	IWA402 wsnp_BE637808A_Ta_2_1
Reference	Petersen S et al. (2016) Mapping of Fusarium Head Blight Resistance Quantitative Trait Loci in Winter Wheat Cultivar NC-Neuse Crop Science 56:1473-1483.
Type	KASP
PCR primers	FAM 5' ATATCAATTAAATGCTACATCATGAACATAGT VIC 5' ATCAATTAAATGCTACATCATGAACATAGC Common 5' TTTAGGAATGGAAGGAGTATCATTCACCA