Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWA4434

[Submit comment/correction]

Locus	IWA4434
Type	SNP
Synonym	Other name BS00183092 wsnp_Ex_c6142_10746442 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	7A
Map	[ Hide all but 1 of 10 ] Durum Wheat, NSGC Lr 7A 192.6 Wheat, 2013 9K Consensus 7A 173.27 Wheat, Yr genes and QTL 7A 69.7 Wheat_2014_90KSNP_7A 212.661 Wheat_2014_i9K_Ug99_PIxLMPG_7A 131.8 Wheat_AB, Latino x MG5323 7A 176.7 Wheat_AB, Simeto x Molise Colli 7A 237.3 Wheat_AB, Svevo x Ciccio 7A 153.8 Wheat_AB_2015_Consensus-7A 192.6 Wheat_Yr_2021-7A 173.27
	[ Show Nearby Loci ]
Map Data	Durum Wheat, NSGC Lr [ Show all 10 ]
Species	Triticum aestivum
Probe	IWA4434 IWA4434 wsnp_Ex_c6142_10746442
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. Cavanagh CR et al. (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars Proceedings of the National Academy of Sciences, USA 110:8057-8062. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
Probe for Locus	IWA4434
Locus	IWA4434
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers	F_ALT: 5' GGCAGCAAGAAGAGAAAGAAAGGATT F_ALC: 5' GCAGCAAGAAGAGAAAGAAAGGATC R: 5' CAGCGGCCTTCACCTGGGCTT
Specificity	Forward primers are allele specific for SNPs T and C, respectively