Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWA4434

[Submit comment/correction]

Locus	IWA4434
Type	SNP
Synonym	Other name BS00183092 wsnp_Ex_c6142_10746442 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	7A
Map	Durum Wheat, NSGC Lr 7A 192.6 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 10 ] Durum Wheat, NSGC Lr Wheat, 2013 9K Consensus Wheat, Yr genes and QTL Wheat, Yr Update, 2021 Wheat_2014_90KSNP Wheat_2014_i9K_Ug99_PIxLMPG Wheat_AB, Latino x MG5323 Wheat_AB, Simeto x Molise Colli Wheat_AB, Svevo x Ciccio Wheat_AB_2015_Consensus
Species	Triticum aestivum
Probe	IWA4434 IWA4434 wsnp_Ex_c6142_10746442
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. Cavanagh CR et al. (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars Proceedings of the National Academy of Sciences, USA 110:8057-8062. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
Probe for Locus	IWA4434
Locus	IWA4434
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers	F_ALT: 5' GGCAGCAAGAAGAGAAAGAAAGGATT F_ALC: 5' GCAGCAAGAAGAGAAAGAAAGGATC R: 5' CAGCGGCCTTCACCTGGGCTT
Specificity	Forward primers are allele specific for SNPs T and C, respectively