Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWA6016

[Submit comment/correction]

Locus	IWA6016
Type	SNP
Synonym	Other name BS00184298 wsnp_JD_c352_546108 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	2B
Map	Durum Wheat, NSGC Lr 2B 100.9 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Durum Wheat, NSGC Lr Langdon_Deletion_PHS_2B Wheat, 2013 9K Consensus Wheat, Yr genes and QTL Wheat, Yr Update, 2021 Wheat_2014_90KSNP Wheat_AB, Svevo x Zavitan Wheat_AB_2015_Consensus
Species	Triticum aestivum
Probe	fcp716_KASP wsnp_JD_c352_546108
Reference	Sharma JS et al. (2019) Mapping and characterization of two stem rust resistance genes derived from cultivated emmer wheat accession PI 193883. Theoretical and Applied Genetics 132:3177-3189. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. Cavanagh CR et al. (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars Proceedings of the National Academy of Sciences, USA 110:8057-8062.
Probe for Locus	fcp716_KASP
Locus	fcp716 IWA6016
Reference	Sharma JS et al. (2019) Mapping and characterization of two stem rust resistance genes derived from cultivated emmer wheat accession PI 193883. Theoretical and Applied Genetics 132:3177-3189.
General Remarks	~Product size (bp) = 25, 50 Inheritance/phase = Dominant/coupling
Type	KASP
PCR primers	F1 {tail-2}CGTTCCGCTTTTAAAGCA F2 {tail-1}CGTTCCGCTTTTAAGACG R GCTACCACCATGTACGATTAATAGG