Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWB48036

[Submit comment/correction]

Locus	IWB48036
Type	SNP
Synonym	Other name BS00152560 Kukri_c855_2107 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	7A
Map	[ Hide all but 1 of 7 ] Wheat, Yr genes and QTL 7A 67.2 Wheat_2014_90KSNP_7A 208.714 Wheat_AB, Meridiano x Claudio 7A_2 91.6 Wheat_AB, Simeto x Molise Colli 7A 235.6 Wheat_AB, Svevo x Ciccio 7A 146.3 Wheat_AB_2015_Consensus-7A 187.1 Wheat_Yr_2021-7A 167.09
	[ Show Nearby Loci ]
Map Data	Wheat, Yr genes and QTL [ Show all 7 ]
Species	Triticum aestivum
Probe	IWAB8036 Kukri_c855_2107
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
Probe for Locus	IWAB8036
Locus	IWB48036
Reference	Babiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers	F_ALA: 5' ATCTCGTTTCCATTCATCTTGTACTTATA F_ALG: 5' CTCGTTTCCATTCATCTTGTACTTATG R: 5' AGCCAGTTGCTCCCACTCTATGTTT
Specificity	Forward primers are allele specific for SNPs A and G, respectively