Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Lr21

[Submit comment/correction]

Locus	Lr21
Type	Gene Trait
Chromosome	1D
Chromosome Arm	1DS 1S
Map	1DS, Ae. tauschii 0 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	1DS, Ae. tauschii [ Show all 6 ]
2 Point Data	[ Hide all but 1 of 10 ] Lr21/Gli-D1#1 Distance: 5.6 cM Lr21/Gli-D1#2 Distance: 18 cM Lr21/Glu-D1#1 Lr21/Lr41#1 Lr21/Lr42#1 Distance: 28.6 cM Lr21/Rg2#1 Distance: 4.2 cM Lr21/XksuD14 Rg2/Lr21#1 Distance: 10.1 cM Rg2/Lr21#2 Distance: 3.1 cM Rg2/Lr21#3 Distance: 1.7 cM
Species	Aegilops tauschii Triticum aestivum
Probe	Lr21 pTtksuD14
Associated Gene	Lr21 (Aegilops) Lr21 (Triticum)
Gene Class	Reaction to Puccinia recondita Rob. ex Desm.
Reference	Spielmeyer W et al. (2000) NBS-LRR sequence family is associated with leaf and stripe rust resistance on the end of homoeologous chromosome group 1S of wheat Theoretical and Applied Genetics 101:1139-1144.
Data Source	Soria, Marcelo A.
Remark	For map 'Wheat, Synthetic x Opata', position approximated from mapping in another population. Trait marker XksuD14-1D Nearby marker on Composite map: XksuD14A Position on Composite map estimated by GrainGenes.
Probe for Locus	pTtksuD14
Locus	ksuD14F [ Show all 28 ]
Type	Genomic STS
PCR primers	R:CCAAAGAGCATCCATGGTGT L:CGCTTTTACCGAGATTGGTC
Specificity	Primer specificity verified, maps on chromosome 1BS.
Polymorphism	KSUD14 EcoRV
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6