Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2028

[Submit comment/correction]

Locus	MWG2028
Type	RFLP
Synonym	Synonym MWG2028
Chromosome	1H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 96.2 [ Show all 15 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 15 ] Barley consensus Barley consensus 2 Barley genes Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP
Species	Hordeum vulgare
Probe	MWG2028
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG2028-1H Xmwg2028
Probe	MWG2028
Locus	MWG2028 Xmwg2028 MWG2028-1H
Type	Genomic STS
STS primers	5' GCTCACATCAATGTGTTCCGACAGC 5' CATGAAGGAAGGCACCACGACTGAA
STS size	242
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	AJ234716 AJ234715 MWG2028-5 MWG2028-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare