Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2036

[Submit comment/correction]

Locus	MWG2036
Type	RFLP
Chromosome	4H
Chromosome Arm	4HL
Map	Barley-Consensus-4H 1.6 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley consensus Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG2036
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG2036B
Probe	MWG2036
Locus	MWG2036B MWG2036
Synonym	Synonym HAR35_11366
Type	Genomic STS
STS primers	5' CCATCTTGAAAGCAGCATCA 5' TGCTGACACAGCCCTTTTC
STS size	190
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234728 AJ234727 MWG2036-5 MWG2036-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare