Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2040A

[Submit comment/correction]

Locus	MWG2040A
Type	RFLP
Chromosome	3H
Map	Hv-Consensus2006-Marcel-3H 137.69 Hv-Integrated2009-3H 148.6
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009
Probe	MWG2040
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG2040 MWG2040B MWG2040C MWG2040D Xmwg2040-3
Probe for Locus	MWG2040
Locus	[ Hide all but 1 of 8 ] MWG2040B MWG2040D MWG2040C Xmwg2040-3 MWG2040 HI051L21 HD051L21 MWG2040A
Type	Genomic STS
STS primers	5' GATGAGATGTGACTTCGACA 5' CTTCACAACATGCCTAAGAT
STS size	319
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234731 MWG2040-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare