Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2053

[Submit comment/correction]

Locus	MWG2053
Type	RFLP
Chromosome	6H
Chromosome Arm	6HL
Map	[ Hide all but 1 of 8 ] Barley-Consensus-6H 82.7 Barley-Consensus2-6H 139.6 Hordeum-Bins-6H 148 Hordeum-Graner2-6H 136.3 Hordeum-KxM-6H 176.5 Hordeum-NABGMP2-6H 186.1 Hv-Consensus2006-Marcel-6H 141.49 Hv-Integrated2009-6H 133
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	MWG2053
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg2053 [ Show all 11 ]
Probe	MWG2053
Locus	MWG2053 [ Show all 13 ]
Type	Genomic STS
STS primers	5' CCCCGGTATCCTCAAATGCA 5' GTTTTCGCGACGATGTCCTT
STS size	ca. 1350
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	BH854313 BH854314 MWG2053-5 MWG2053-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare