Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2065

[Submit comment/correction]

Locus	MWG2065
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	[ Hide all but 1 of 8 ] Barley-Consensus-3H 2.8 Hordeum-Bins-3H 62 Hordeum-Bins-6H 47 Hordeum-Graner2-3H 58.4 Hordeum-HxT-base-6H 43 Hordeum-NABGMP2-6H 47.4 Hv-Consensus2006-Marcel-3H 58.01 Hv-Integrated2009-3H 68.9
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Probe	MWG2065
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG2065(HT) MWG2065(IF)
Probe	MWG2065
Locus	MWG2065 MWG2065(IF) MWG2065(HT)
Type	Genomic STS
STS primers	5' GGGAGCACGAGGGAGACGTT 5' CCTCTTCGTGCAAGCTTCGA
STS size	266
Amplification Conditions	STS annealing temperature 62-65 oC
Sequence	AJ234747 AJ234746 MWG2065-5 MWG2065-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare