Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG502

[Submit comment/correction]

Locus	MWG502
Type	CAPS RFLP STS
Synonym	Synonym MWG502
Chromosome	5H 7 (5H)
Chromosome Arm	5HS
Map	Barley-Consensus-5H -51.7 [ Show all 28 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.DON_5H_1 MetaQ.FHB_5H_1 MetaQ.HT_5H_1 QFge.HaTR-5H.1 QGms.HaTR-5H
Map Data	[ Hide all but 1 of 28 ] Barley consensus Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxK Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, HN x H602, Sato2009 Barley, HxT Barley, HxT basemap Barley, Integrated, Marcel 2009 Barley, IxF Barley, KxM Barley, L94 x Vada, 2006 Barley, physical Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs Barley, TxE Barley, VxHs Barley, Zhedar2, FHB QTL
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG502
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG502 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex; Igri x Franka
Possible Orthologs	Xmwg502 Xmwg502-5R
Probe	MWG502
Locus	MWG502 Xmwg502 Xmwg502-5R
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Sayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Remarks	Restriction Enzyme for CAPS marker is Msp I; Hpa II
Type	Genomic STS
PCR primers	5' tgtttagctaagctgttgctgagg 3' 5' ctctgaagcatggaaccagatttg 3'
STS primers	T7 side (5' to 3') ATCAAGATGAGGAAGCTGATGCAGT T3 side (5' to 3') TCTTGTCTGAAGCATGGAACCAGAT
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 55 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234471 AJ234470 MWG502 MWG502-5 MWG502-3
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.9