Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG503

[Submit comment/correction]

Locus	MWG503
Type	RFLP STS
Synonym	Synonym MWG503
Chromosome	2H
Chromosome Arm	2HL
Map	[ Hide all but 1 of 37 ] Barley-consensus-2003-2H 94.9 Barley-Consensus-2H 21.1 Barley-Consensus2-2H 93.5 Barley-ConsensusFHB-2H 90.43 Barley-ConsensusFHB-5H 98.99 Hordeum-AxK-2H 92.6 Hordeum-Bins-2H 101.3 Hordeum-Consensus2005-SNP-2H 92.345 Hordeum-Consensus2006-DArT-2H 100.8 Hordeum-Consensus2007-SSR-2H 95.05 Hordeum-CxH-2H 130.7 Hordeum-FxS-FHB-QTL-2H 137.7 Hordeum-Giese1-2H 52 Hordeum-Giese2-2H 94 Hordeum-Graner1-2H 201.5 Hordeum-Graner2-2H 115 Hordeum-HxM-base-2H 97 Hordeum-IxF-SSR-2H 127.2 Hordeum-NABGMP1-2H 104.3 Hordeum-NABGMP2-2H 142.1 Hordeum-OPA-2009-2H 157.62 Hordeum-OWB-2004-2H 105.5 Hordeum-OWB-2005-2H 102.1 Hordeum-OWB-2H 104.2 Hordeum-OWB-OPA2008-2H 113.486 Hordeum-OWB-SNP-2H 110.59 Hordeum-PilotOPA1-2H 101.5 Hordeum-QTLConsensus-Abiotic-2H 92.34 Hordeum-QTLConsensus-Agronomic-2H 92.34 Hordeum-StMo-SNP-2H 91.04 Hordeum-SxM-base-2H 99.1 Hordeum-SxM-FeedQTL-2H 104.3 Hordeum-SxM-SSAP-2H 102.9 Hordeum-SxM-SSR-2H 126.5 Hordeum-Zhedar2-FHB-QTL-2H 142.7 Hv-Consensus2006-Marcel-2H 95.05 Hv-Integrated2009-2H 89.6
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_2H_34 [ Show all 22 ]
Map Data	Barley consensus [ Show all 36 ]
2 Point Data	MWG503/Xris45c Distance: 9 cM v/MWG503 Distance: 10 cM
Species	Hordeum vulgare
Probe	MWG503
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 8 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of MWG503 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG503(A) MWG503(B) MWG503-2H Xmwg503 Xmwg503-2
Probe	MWG503
Locus	Xmwg503-2 [ Show all 7 ]
Synonym	Synonym HAR35_18355
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
PCR primers	MWG503T3 GTCGTCAGAGCCCACGCCAC MWG503T7 TCCAAGCGGCAACCATCCCG
STS primers	5' CGCCACACGTAGAGTATGTT 5' GACGACCAGATCAAGCATGA
STS size	413
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234472 MWG503 MWG503-5
Linkage Group	2
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.6