Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG503

[Submit comment/correction]

Locus	MWG503
Type	RFLP STS
Synonym	Synonym MWG503
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-consensus-2003-2H 94.9 [ Show all 37 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_2H_34 [ Show all 22 ]
Map Data	[ Hide all but 1 of 36 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxK Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, CxH Barley, FxS, FHB QTL Barley, HxM/QTL Barley, HxT Barley, Igri x Franka, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, OPA 2009, Consensus Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs Barley, VGxA Barley, VGxTP Barley, VxHs Barley, Zhedar2, FHB QTL
2 Point Data	MWG503/Xris45c Distance: 9 cM v/MWG503 Distance: 10 cM
Species	Hordeum vulgare
Probe	MWG503
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 8 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of MWG503 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG503(A) MWG503(B) MWG503-2H Xmwg503 Xmwg503-2
Probe	MWG503
Locus	Xmwg503-2 [ Show all 7 ]
Synonym	Synonym HAR35_18355
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
PCR primers	MWG503T3 GTCGTCAGAGCCCACGCCAC MWG503T7 TCCAAGCGGCAACCATCCCG
STS primers	5' CGCCACACGTAGAGTATGTT 5' GACGACCAGATCAAGCATGA
STS size	413
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234472 MWG503 MWG503-5
Linkage Group	2
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.6