Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG514

[Submit comment/correction]

Locus	MWG514
Type	RFLP
Synonym	Synonym MWG514B
Chromosome	5H 6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-5H 31.4 [ Show all 12 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHd.IgTr-6H.2 QHt.IgDa-6H QScd.IgDa-6H.2
Map Data	[ Hide all but 1 of 12 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, BinMap 2005 Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, GxH Barley, IxF Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, VxHs
Species	Hordeum vulgare
Probe	MWG514
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	MWG514A MWG514B MWG514b-5H Xmwg514 Xmwg514-3R
Probe	MWG514
Locus	MWG514 [ Show all 6 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTGCATTAATACAGTGCCCA 5' CACAAACGTTACGAGTACAG
STS size	472
Amplification Conditions	STS annealing temperature 50-52 oC
Sequence	AJ234478 AJ234477 MWG514-5 MWG514-3
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1