Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG514B

[Submit comment/correction]

Locus	MWG514B
Type	RFLP
Synonym	Synonym MWG514
Chromosome	5H
Map	Barley-Consensus2-5H 133.7 [ Show all 17 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QSss.StMo-5H.1
Map Data	Barley consensus 2 [ Show all 17 ]
Species	Hordeum vulgare
Probe	MWG514
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of MWG514B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG514 MWG514A MWG514b-5H Xmwg514 Xmwg514-3R
Probe for Locus	MWG514
Locus	[ Hide all but 1 of 6 ] MWG514 MWG514B MWG514A Xmwg514 Xmwg514-3R MWG514b-5H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTGCATTAATACAGTGCCCA 5' CACAAACGTTACGAGTACAG
STS size	472
Amplification Conditions	STS annealing temperature 50-52 oC
Sequence	AJ234478 AJ234477 MWG514-5 MWG514-3
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1