Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG542

[Submit comment/correction]

Locus	MWG542
Type	RFLP
Chromosome	4H
Chromosome Arm	4HL
Map	[ Hide all but 1 of 7 ] Barley-Consensus-4H 14.9 Barley-Consensus2-4H 65.3 Hordeum-Bins-4H 65 Hordeum-Graner1-4H 200 Hordeum-Graner2-4H 74.2 Hv-Consensus2006-Marcel-4H 78.62 Hv-Integrated2009-4H 89.3
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Probe	MWG542
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG542
Locus	MWG542
Synonym	Synonym HAR35_46539
Type	Genomic STS
STS primers	5' CACTCACAGGCTTCGTTGCT 5' GCTCTGCTCTGCTCTGCTCA
STS size	245
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234496 AJ234495 MWG542-5 MWG542-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare