Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG549a

[Submit comment/correction]

Locus	MWG549a
Type	RFLP
Chromosome	6H
Map	Barley-Consensus2-6H 96 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG549
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG549 [ Show all 9 ]
Probe for Locus	MWG549
Locus	MWG549 [ Show all 10 ]
Type	Genomic STS
STS primers	5' CTTAACTTTTGAAGGGCACG 5' GCAGGTGTGTCATCAGTGTA
STS size	392
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	AJ234498 MWG549 MWG549-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare