Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG555b

[Submit comment/correction]

Locus	MWG555b
Type	RFLP
Synonym	Synonym MWG555
Chromosome	3H
Map	Barley-Consensus2-3H 61.9 [ Show all 19 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QPm.IgDa-7H
Map Data	[ Hide all but 1 of 19 ] Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Igri x Franka, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, physical Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	MWG555
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG555B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG555 MWG555a MWG555a-7H MWG555b-3H
Probe for Locus	MWG555
Locus	MWG555 MWG555b MWG555a MWG555a-7H MWG555b-3H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CGATTTGTTGGCACACATCA 5' GCAGTATCATCTCACCCGAA
STS size	213
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234503 MWG555-5
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.8