Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG564

Locus	MWG564
Type	RFLP
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-Consensus-7H -49.7 [ Show all 8 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.DON_7H_3 MetaQ.FHB_7H_3 MetaQ.HD_7H_3 MetaQ.HD_7H_4 QHD.umn-7H.1
Map Data	[ Hide all but 1 of 8 ] Barley consensus Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG564
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG564
Locus	MWG564
Type	Genomic STS
STS primers	5' TCTGTTTGGAAGGCTTCTGCC 5' ATACGGCTACTACGCCGACTGG
STS size	227
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234509 AJ234508 MWG564-5 MWG564-3
Linkage Group	7H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.8