Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG573B

[Submit comment/correction]

Locus	MWG573B
Type	CAPS RFLP
Map	Hordeum-Bins-7H 70 Hv-Integrated2009-7H 65.7
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Integrated, Marcel 2009
Probe	MWG573
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Cebada Capa x SusPtrit
Possible Orthologs	[ Hide all but 1 of 11 ] MWG573 MWG573(HT) MWG573(IF) MWG573A Xmwg573 Xmwg573-6A Xmwg573-6B Xmwg573a Xmwg573b mwg573 mwg573-6A
Probe for Locus	MWG573
Locus	MWG573 [ Show all 12 ]
Synonym	Synonym HAR35_18027 HAR35_50874
Type	Genomic STS
STS primers	5' CTGCACTCATGTCAGCAAGA 5' GACCAACGGGAGATGCTCGT
STS size	240
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234515 AJ234514 MWG573-5 MWG573-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare