Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG595

[Submit comment/correction]

Locus	MWG595
Type	RFLP
Chromosome	3 (3H) 3H
Chromosome Arm	3HL
Map	[ Hide all but 1 of 9 ] Barley-Consensus-3H 0.9 Barley-Consensus2-3H 44 Hordeum-Bins-3H 64 Hordeum-Giese2-3H 104 Hordeum-Graner1-3H 106 Hordeum-Graner2-3H 52.7 Hordeum-TxE-3H 50.5 Hv-Consensus2006-Marcel-3H 45.59 Hv-Integrated2009-3H 55.9
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 9 ]
Probe	MWG595
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg595-3
Probe	MWG595
Locus	Xmwg595-3 MWG595
Type	Genomic STS
STS primers	5' TGCCGGTGGTATTGTCG 5' TCGGCAGTAGCACAGGTATG
STS size	223
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234526 AJ234525 MWG595-5 MWG595-3
Linkage Group	3H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.8