Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG602A

[Submit comment/correction]

Locus	MWG602A
Type	RFLP
Synonym	Synonym MWG602
Chromosome	5H
Map	Hordeum-Consensus2005-SNP-5H 203.543 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 10 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP
Species	Hordeum vulgare
Probe	MWG602
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG602 MWG602a-5H MWG602B Xmwg602
Probe for Locus	MWG602
Locus	MWG602 MWG602B MWG602A MWG602a-5H Xmwg602
Type	Genomic STS
STS primers	5' CCACTGTATGAACACAGGGA 5' GACCACAGGAAGAGGTCGTT
STS size	271
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234532 AJ234531 MWG602-5 MWG602-3
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.5