Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG618

[Submit comment/correction]

Locus	MWG618
Type	RFLP STS
Synonym	Synonym MWG618
Chromosome	5H
Map	Barley-Consensus2-5H 22.8 [ Show all 15 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 15 ] Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF Barley, L94 x Vada, 2006 Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP Barley, physical
Species	Hordeum vulgare
Probe	MWG618
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG618-5H
Probe	MWG618
Locus	MWG618 MWG618-5H
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type	Genomic STS
PCR primers	5' gccgctaaaacacatcaaac 3' 5' gccgctaaaacacatcaaac 3' 5' tattttcagtcccgcacac 3' 5' tattttcagtcccgcacac 3'
STS primers	5' TGATTGTATCGGATGATTGC 5' AGCTGAGAAATGAAGAAGGG
STS size	180
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 65 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234539 AJ234538 MWG618-5 MWG618-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare