Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG634

[Submit comment/correction]

Locus	MWG634
Type	CAPS RFLP
Synonym	Synonym MWG634
Chromosome	4H
Chromosome Arm	4HS
Map	Barley-Consensus-4H -59.1 [ Show all 27 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QSsg.StMo-4H
Map Data	Barley consensus [ Show all 27 ]
Species	Hordeum vulgare
Probe	MWG634
Reference	[ Hide all but 1 of 7 ] Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of MWG634 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Nure x Tremois Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG634-4H [ Show all 16 ]
Probe	MWG634
Locus	Xmwg634.2-4A [ Show all 17 ]
Reference	Sayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	T7 side (5' to 3') GTGCTGGGTGGATTAAAAAAGAGGG T3 side (5' to 3') GAACTAAAGATAGGCGGGAGTACTG
Sequence	AJ234549 AJ234548 MWG634 MWG634-5 MWG634-3
Linkage Group	?
Source Species	Hordeum vulgare
Insert Size	0.7