Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG635C

[Submit comment/correction]

Locus	MWG635C
Type	RFLP
Synonym	Synonym MWG635
Chromosome	1H
Map	[ Hide all but 1 of 11 ] Barley-Consensus2-1H 139.9 Hordeum-Bins-1H 145.8 Hordeum-Consensus2005-SNP-1H 138.419 Hordeum-Genes-1H -50.9 Hordeum-NABGMP1-1H 138.9 Hordeum-QTLConsensus-Abiotic-1H 138.42 Hordeum-QTLConsensus-Agronomic-1H 138.42 Hordeum-StMo-SNP-1H 146.28 Hordeum-SxM-FeedQTL-1H 138.9 Hv-Consensus2006-Marcel-1H 126.37 Hv-Integrated2009-1H 128.1
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 11 ]
Probe	MWG635
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	MWG635 [ Show all 7 ]
Probe for Locus	MWG635
Locus	MWG635C [ Show all 10 ]
Synonym	Synonym HAR35_27222 HAR35_27940
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' ACCGACGCAGACCTTCAG 5' TCAAGACCATGAAGCACGAG
STS size	178
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234550 MWG635-5 MWG635-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare