Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG635b

[Submit comment/correction]

Locus	MWG635b
Type	RFLP
Synonym	Synonym MWG635
Chromosome	1H 5H 7H
Map	Barley-Consensus2-7H 143.1 [ Show all 18 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.HD_5H_1 QHD.umn-5H.1
Map Data	[ Hide all but 1 of 18 ] Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, HxT Barley, HxT basemap Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs Barley, VGxTP
Probe	MWG635
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG635B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	MWG635 [ Show all 7 ]
Probe for Locus	MWG635
Locus	MWG635C [ Show all 10 ]
Synonym	Synonym HAR35_27222 HAR35_27940
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' ACCGACGCAGACCTTCAG 5' TCAAGACCATGAAGCACGAG
STS size	178
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234550 MWG635-5 MWG635-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare