Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG798B

[Submit comment/correction]

Locus	MWG798B
Type	RFLP
Synonym	Synonym MWG798
Chromosome	3H
Map	Barley-Consensus2-3H 17.4 [ Show all 20 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 20 ] Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Integrated, Marcel 2009 Barley, OPA 2009, Consensus Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	MWG798
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 7 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of MWG798B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG798 [ Show all 7 ]
Probe for Locus	MWG798
Locus	MWG798A [ Show all 8 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GGCTGTCTACATCTTCTGCA 5' CAAGTGTTGAGAAGGAGAGT
STS size	365
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234554 AJ234553 MWG798-5 MWG798-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare