Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG800

[Submit comment/correction]

Locus	MWG800
Type	RFLP
Synonym	Synonym MWG800 POPA2_1333
Chromosome	1H
Chromosome Arm	1HL
Map	[ Hide all but 1 of 13 ] Barley-Consensus-1H 16.8 Barley-Consensus2-1H 79.1 Barley-ConsensusFHB-1H 64.8 Hordeum-Bins-1H 77.8 Hordeum-Consensus2005-SNP-1H 74.152 Hordeum-Genes-1H 20.4 Hordeum-Graner2-1H 44.6 Hordeum-Physical-RFLP-1H 59.2 Hordeum-QTLConsensus-Abiotic-1H 74.15 Hordeum-QTLConsensus-Agronomic-1H 74.15 Hordeum-StMo-SNP-1H 81.28 Hv-Consensus2006-Marcel-1H 65.87 Hv-Integrated2009-1H 66.5
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 15 ]
Probe	MWG800
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	MWG800-1H Xmwg800-1
Probe	MWG800
Locus	MWG800 Xmwg800-1 MWG800-1H
Synonym	Synonym HAR35_3315 HAR35_5111
Type	Genomic STS
STS primers	5' GTCCGTAACCTGTGGTACTG 5' GCAGCTAAGTTGGCTAGAGC
STS size	400
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234557 MWG800-5
Linkage Group	1H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.8