Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG820

[Submit comment/correction]

Locus	MWG820
Type	RFLP
Synonym	Synonym MWG820
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-6H 57.2 [ Show all 28 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QGms.HaTR-6H QHd.IgTr-6H.1
Map Data	[ Hide all but 1 of 28 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, GxH Barley, HxT Barley, HxT basemap Barley, Igri x Franka, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, KxM Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	MWG820
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of MWG820 in the Barley, Consensus 2006 DArT maps = 3 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG820-6H [ Show all 8 ]
Probe	MWG820
Locus	MWG820 [ Show all 9 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GGGGAGAAAATGCATGCAAT 5' CAGCGTCGTATAAATGTCTT
STS size	265
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234573 AJ234572 MWG820-5 MWG820-3
Linkage Group	6H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.5