Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG847

[Submit comment/correction]

Locus	MWG847
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	[ Hide all but 1 of 11 ] Barley-Consensus-3H 48.8 Barley-Consensus2-3H 80.9 Barley-ConsensusFHB-3H 112.81 Hordeum-Bins-3H 130 Hordeum-Consensus2007-SSR-3H 107.19 Hordeum-Graner2-3H 101.1 Hordeum-HxT-base-3H 92.9 Hordeum-NABGMP2-3H 31.7 Hordeum-Physical-RFLP-3H 136.5 Hv-Consensus2006-Marcel-3H 107.19 Hv-Integrated2009-3H 118.1
	[ Show Nearby Loci ]
QTL with Locus Marker	QBgnm.HaTR-3H.2
Map Data	Barley consensus [ Show all 11 ]
Species	Hordeum vulgare
Probe	MWG847
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	Xmwg847-3
Probe	MWG847
Locus	Xmwg847-3 MWG847
Type	Genomic STS
STS primers	5' GTCTTGGCCAGCTACTCCCG 5' CGCACCTGCACCAGAGGTCC
STS size	345
Amplification Conditions	STS annealing temperature 65-67 oC
Sequence	AJ234586 MWG847-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare