Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG865

[Submit comment/correction]

Locus	MWG865
Type	RFLP STS
Synonym	Synonym MWG865
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-consensus-2003-2H 89.3 [ Show all 20 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QDon.umn-2H.1 QFhs.umn-2H.3 QLg.HaTR-2H
Map Data	[ Hide all but 1 of 20 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxK Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, CxH Barley, FxS, FHB QTL Barley, HxT Barley, HxT basemap Barley, Integrated, Marcel 2009 Barley, IxF Barley, OPA 2009, Consensus Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP
Species	Hordeum vulgare
Probe	MWG865
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Close, Timothy J. Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	XMWG865
Probe	MWG865
Locus	MWG865 XMWG865
Type	Genomic STS
PCR primers	MWG865T3-2 GGTTGTTGCCCTGTTGCTGT MWG865T7-4 GACAGTAACATTTCGGAATC
STS primers	5' GCCCTGTTGCTGTACTAAAA 5' CTAACGAACTGTGCATGATT
STS size	306
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234600 AJ234599 MWG865 MWG865-5 MWG865-3
Polymorphism	MWG865 EcoRI
Linkage Group	2H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.6