Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG877

Locus	MWG877
Type	RFLP
Synonym	Synonym MWG877
Chromosome	5H
Chromosome Arm	5HL
Map	[ Hide all but 1 of 24 ] Barley-Consensus-5H 77.3 Barley-Consensus2-5H 149.1 Barley-ConsensusFHB-5H 145.31 Hordeum-Bins-5H 152.5 Hordeum-Consensus2005-SNP-5H 148 Hordeum-Consensus2006-DArT-5H 142.7 Hordeum-Graner2-5H 164.3 Hordeum-IxF-SSR-5H 156.4 Hordeum-NABGMP1-5H 157.5 Hordeum-OWB-2004-5H 161.7 Hordeum-OWB-2005-5H 169 Hordeum-OWB-5H 149.8 Hordeum-OWB-OPA2008-5H 179.39 Hordeum-OWB-SNP-5H 123.08 Hordeum-Physical-RFLP-5H 207.2 Hordeum-QTLConsensus-Abiotic-5H 148 Hordeum-QTLConsensus-Agronomic-5H 148 Hordeum-StMo-SNP-5H 138.7 Hordeum-SxM-base-5H 155.3 Hordeum-SxM-FeedQTL-5H 157.5 Hordeum-SxM-SSAP-5H 142.6 Hordeum-SxM-SSR-5H 171.7 Hv-Consensus2006-Marcel-5H 133.22 Hv-Integrated2009-5H 131.1
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 24 ]
Species	Hordeum vulgare
Probe	MWG877
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG877 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG877-5H
Probe	MWG877
Locus	MWG877 MWG877-5H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CCGTGATACACCTGGTGATATATG 5' CACAAGAAAGCAGCTCCTCCATT
STS size	ca. 1150
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234609 AJ234608 MWG0877-5 MWG0877-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare