Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG892

[Submit comment/correction]

Locus	MWG892
Type	RFLP
Chromosome	2H
Chromosome Arm	2HL
Map	[ Hide all but 1 of 8 ] Barley-consensus-2003-2H 97.1 Barley-Consensus-2H 22.2 Barley-Consensus2-2H 90.1 Hordeum-Bins-2H 98 Hordeum-CxS-2H 126.83 Hordeum-Graner2-2H 117.8 Hv-Consensus2006-Marcel-2H 97.23 Hv-Integrated2009-2H 91.9
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	MWG892
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG892
Locus	MWG892
Synonym	Synonym HAR35_20829 HAR35_22677 HAR35_26535
Type	Genomic STS
STS primers	5' CAGAAGTAGAGGAAGCTCTT 5' GCCCTTTACATTCAGTCGAA
STS size	327
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234627 AJ234626 MWG892-5 MWG892-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare