Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG911A

[Submit comment/correction]

Locus	MWG911A
Type	RFLP
Chromosome	6H
Map	Hordeum-Bins-6H 146 Hv-Consensus2006-Marcel-6H 128.76 Hv-Integrated2009-6H 127.9
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009
Probe	MWG911
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG911 MWG911(IF) MWG911(SM) MWG911a-6H MWG911B
Probe for Locus	MWG911
Locus	[ Hide all but 1 of 6 ] MWG911 MWG911(SM) MWG911(IF) MWG911A MWG911B MWG911a-6H
Type	Genomic STS
STS primers	5' GATGTCGTCGACGTAGAGAA 5' CATGGCCTGTACATCAGCTT
STS size	291
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234641 MWG911-5
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.7