Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG911B

[Submit comment/correction]

Locus	MWG911B
Type	CAPS RFLP
Synonym	Synonym MWG911
Chromosome	7H
Map	[ Hide all but 1 of 8 ] Hordeum-Bins-7H 69.6 Hordeum-Consensus2005-SNP-7H 82.133 Hordeum-QTLConsensus-Abiotic-7H 82.13 Hordeum-QTLConsensus-Agronomic-7H 82.13 Hordeum-StMo-SNP-7H 68.2 Hv-Consensus2006-Marcel-7H 73.21 Hv-Integrated2009-7H 74.4 Hv-L94/Vada-2006-7H 72.34
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum vulgare
Probe	MWG911 MWG911B
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex
Possible Orthologs	MWG911 MWG911(IF) MWG911(SM) MWG911A MWG911a-6H
Probe for Locus	MWG911
Locus	MWG911 [ Show all 6 ]
Type	Genomic STS
STS primers	5' GATGTCGTCGACGTAGAGAA 5' CATGGCCTGTACATCAGCTT
STS size	291
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234641 MWG911-5
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.7