Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG913

[Submit comment/correction]

Locus	MWG913
Type	RFLP
Chromosome	1H
Chromosome Arm	1HL
Map	[ Hide all but 1 of 8 ] Barley-Consensus-1H 2.3 Barley-Consensus2-1H 65.8 Hordeum-Bins-1H 55 Hordeum-Genes-1H 29.7 Hordeum-Graner2-1H 34.6 Hordeum-Physical-RFLP-1H 49.3 Hv-Consensus2006-Marcel-1H 57.78 Hv-Integrated2009-1H 58.2
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	MWG913
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg913a Xmwg913b
Probe	MWG913
Locus	MWG913 Xmwg913a Xmwg913b
Synonym	Synonym HAR35_16128 HAR35_1714
Type	Genomic STS
STS primers	5' GCACCCTTGAAGCAGACATCG 5' GCCATGAGCGGGAATTTGC
STS size	370
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234643 MWG913 MWG913-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare