Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG916

[Submit comment/correction]

Locus	MWG916
Type	CAPS RFLP
Chromosome	6H
Chromosome Arm	6HS
Map	[ Hide all but 1 of 12 ] Barley-Consensus-6H -16.2 Barley-Consensus2-6H 51 Barley-ConsensusFHB-6H 45.9 Hordeum-Bins-6H 51 Hordeum-FxS-FHB-QTL-6H 37.1 Hordeum-Graner2-6H 43 Hordeum-HxT-base-6H 50.2 Hordeum-KxM-6H 42.6 Hordeum-NABGMP2-6H 54.1 Hordeum-RxK-NTNB-6H 66.3 Hv-Consensus2006-Marcel-6H 47.77 Hv-Integrated2009-6H 47.2
	[ Show Nearby Loci ]
QTL with Locus Marker	QNb.HaTR-6H QScd.HaTR-6H
Map Data	Barley consensus [ Show all 12 ]
Species	Hordeum vulgare
Probe	MWG916
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg916 [ Show all 6 ]
Probe	MWG916
Locus	MWG916 [ Show all 7 ]
Synonym	Synonym HAR35_35585
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
Remarks	Restriction enzyme informative in CAP analysis is HaeIII
Type	Genomic STS
STS primers	5' GCGGACCAGATCAATATCGA 5' CGACGTAGGGAAACACGCAT
STS size	196
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234646 AJ234645 MWG916-5 MWG916-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare