Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG920-1B

[Submit comment/correction]

Locus	MWG920-1B
Type	RFLP
Chromosome	1H
Map	Hv-Consensus2006-Marcel-1H 11.68 Hv-Integrated2009-1H 13.3
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, SxM Barley, SxM, Feed QTLs
Probe	MWG920
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	[ Hide all but 1 of 13 ] MWG920 MWG920-1A MWG920.1A MWG920.1a-5H MWG920.1B MWG920A Xmwg920 Xmwg920-1A.1 Xmwg920-1A.2 Xmwg920-2A Xmwg920-5A Xmwg920.1 Xmwg920.2
Probe for Locus	MWG920
Locus	MWG920 [ Show all 20 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTCACCGCCCGTCACGTTGCGCTTCA 5' GAGTACCGCGACCGTCGCGCTCGAGC
STS size	183
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234647 MWG920-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare