Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG920.1A

[Submit comment/correction]

Locus	MWG920.1A
Type	RFLP
Synonym	Synonym MWG920
Chromosome	5H
Map	Hordeum-Bins-5H 9.9 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 6 ]
Probe	MWG920
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Close, Timothy J.
Possible Orthologs	MWG920 [ Show all 13 ]
Probe for Locus	MWG920
Locus	[ Hide all but 1 of 20 ] MWG920 HD020D12 RI003F19 HI095K12 HI095K13 HD015M18 HD054L6 Xmwg920 MWG920-1A MWG920-1B MWG920A Xmwg920-1A.1 Xmwg920-1A.2 Xmwg920-2A Xmwg920-5A MWG920.1B MWG920.1A Xmwg920.1 MWG920.1a-5H Xmwg920.2
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTCACCGCCCGTCACGTTGCGCTTCA 5' GAGTACCGCGACCGTCGCGCTCGAGC
STS size	183
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234647 MWG920-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare