Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG949

[Submit comment/correction]

Locus	MWG949
Type	RFLP
Chromosome	2H
Chromosome Arm	2HL
Map	[ Hide all but 1 of 6 ] Barley-Consensus-2H 88.3 Barley-Consensus2-2H 147 Barley-ConsensusFHB-2H 175.33 Hordeum-Consensus2006-DArT-2H 163.3 Hordeum-Graner2-2H 193.9 Hordeum-HxM-base-2H 177.4
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	MWG949
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of MWG949 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	MWG949A MWG949a-2H MWG949B Xmwg949 Xmwg949-2R
Probe	MWG949
Locus	MWG949 [ Show all 6 ]
Synonym	Synonym HAR35_19354
Remarks	MWG949 comes from a digest of MWG950 plasmid DNA and excising the 1.8 kb fragment.
Type	Genomic STS
STS primers	5' CGGCTGGTAAATGAACTGAA 5' GGCTTCCGCTACTACGTCTT
STS size	ca. 1800
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234667 AJ234666 MWG949-5 MWG949-3
Linkage Group	2
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.8