Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG949A

[Submit comment/correction]

Locus	MWG949A
Type	RFLP
Synonym	Synonym wst7 (Hordeum)
Chromosome	2H
Map	Hordeum-Bins-2H 166 [ Show all 11 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 11 ]
Species	Hordeum vulgare
Probe	MWG949
Associated Gene	wst7 (Hordeum)
Gene Class	White striped leaf
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Costa JM et al. (2001) Molecular mapping of the Oregon Wolfe Barleys: a phenotypically polymorphic doubled-haploid population Theoretical and Applied Genetics 103:415-424.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG949 MWG949a-2H MWG949B Xmwg949 Xmwg949-2R
Probe for Locus	MWG949
Locus	[ Hide all but 1 of 6 ] MWG949 Xmwg949 MWG949B MWG949A Xmwg949-2R MWG949a-2H
Synonym	Synonym HAR35_19354
General Remarks	MWG949 comes from a digest of MWG950 plasmid DNA and excising the 1.8 kb fragment.
Type	Genomic STS
STS primers	5' CGGCTGGTAAATGAACTGAA 5' GGCTTCCGCTACTACGTCTT
STS size	ca. 1800
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234667 AJ234666 MWG949-5 MWG949-3
Linkage Group	2
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.8