Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG967b

[Submit comment/correction]

Locus	MWG967b
Type	RFLP
Chromosome	6H
Map	Barley-Consensus2-6H 74.1 Hordeum-Bins-6H 89 Hordeum-Graner2-6H 73.4 Hv-Consensus2006-Marcel-6H 75.67 Hv-Integrated2009-6H 76.1
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG967
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG967a Xmwg967 Xmwg967-1D
Probe for Locus	MWG967
Locus	[ Hide all but 1 of 8 ] Xmwg967-1D MWG967b MWG967a HI054M2 HI089M19 HD015M2 D1.1_ctg11375 Xmwg967
Synonym	Synonym HAR35_6809
Type	Genomic STS
STS primers	5' GCGACGGGCAGCAAGAAAAA 5' CTGAGGGCCAGTGGGATCTT
STS size	171
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234684 AJ234683 MWG967-5 MWG967-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare