Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Pina-D1

[Submit comment/correction]

Gene	Pina-D1
Synonym	Synonym Pina-D1 (Triticum)
Gene Product	puroindoline a puroindoline-a
Comment	See Pina-D1 (Triticum) record for all non-EST data. Curated genes in GrainGenes have the genus in parenthesis following the gene name
Sequence	[ Hide all but 1 of 118 ] AY251996 AY251996_1.cds AY251997 AY251997_1.cds AY251998 AY251998_1.cds AY251999 AY251999_1.cds AY252000 AY252000_1.cds AY252001 AY252001_1.cds AY252002 AY252002_1.cds AY252003 AY252003_1.cds AY252004 AY252004_1.cds AY252005 AY252005_1.cds AY252006 AY252006_1.cds AY252007 AY252007_1.cds AY252008 AY252008_1.cds AY252009 AY252009_1.cds AY252010 AY252010_1.cds AY252011 AY252011_1.cds AY252012 AY252012_1.cds AY252013 AY252013_1.cds AY252014 AY252014_1.cds AY252015 AY252015_1.cds AY252016 AY252016_1.cds AY252017 AY252017_1.cds AY252018 AY252018_1.cds AY252019 AY252019_1.cds AY252020 AY252020_1.cds AY252021 AY252021_1.cds AY252022 AY252022_1.cds AY252023 AY252023_1.cds AY252024 AY252024_1.cds AY252025 AY252025_1.cds AY252026 AY252026_1.cds AY252027 AY252027_1.cds AY252028 AY252028_1.cds AY252029 AY252029_1.cds AY252030 AY252030_1.cds AY252031 AY252031_1.cds AY252032 AY252032_1.cds AY252033 AY252033_1.cds AY252034 AY252034_1.cds AY252035 AY252035_1.cds AY252036 AY252036_1.cds AY252037 AY252037_1.cds AY252038 AY252038_1.cds AY252039 AY252039_1.cds AY252040 AY252040_1.cds AY252041 AY252041_1.cds AY252042 AY252042_1.cds AY252043 AY252043_1.cds AY252044 AY252044_1.cds AY252045 AY252045_1.cds AY573898 AY573898_1.cds AY573899 AY573899_1.cds AY573900 AY573900_1.cds AY649744 AY649744_1.cds AY649745 AY649745_1.cds AY649746 AY649746_1.cds DQ124421 DQ124421_1.cds DQ363911 DQ363911_1.cds DQ363912 DQ363912_1.cds
Locus	Pina-D1
Type	Gene
Synonym	Other name Pina-D1a
Chromosome	5D 5D Triticum aestivum
Chromosome Arm	5DS
Map	Wheat-2014-Consensus-Ug99-Update_5D 8.02 Wheat-Composite2004-5D 0
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat-2014-Consensus-Ug99-Update
Species	Triticum aestivum
Probe	Pina
Associated Gene	Pina-D1 (Triticum)
Gene Class	Grain hardness Puroindolines and grain softness protein
Reference	Beecher B et al. (2002) Expression of wild-type pinB sequence in transgenic wheat complements a hard phenotype Theoretical and Applied Genetics 105:870-877.
Possible Orthologs	Pina Pina-A
Probe for Locus	Pina
Locus	Pina-D1 Pina
Reference	Yu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581. Beecher B et al. (2002) Expression of wild-type pinB sequence in transgenic wheat complements a hard phenotype Theoretical and Applied Genetics 105:870-877.
Type	PCR STS
PCR primers	Forward 5' CCCTGTAGAGACAAAGCTAA 3' Reverse 5' TCACCAGTAATAGCCAATAGTG 3'
Source Species	Triticum aestivum