Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WG464

[Submit comment/correction]

Locus	WG464
Type	RFLP
Synonym	Synonym WG464
Chromosome	4H
Chromosome Arm	4HL
Map	[ Hide all but 1 of 16 ] Barley-Consensus-4H 6.7 Barley-Consensus2-4H 60.1 Hordeum-Bins-4H 59.7 Hordeum-Consensus2005-SNP-4H 58.071 Hordeum-Consensus2006-DArT-4H 76.3 Hordeum-CxS-4H 69.88 Hordeum-Giese2-4H 37 Hordeum-NABGMP1-4H 76.6 Hordeum-QTLConsensus-Abiotic-4H 58.07 Hordeum-QTLConsensus-Agronomic-4H 58.07 Hordeum-StMo-SNP-4H 59.43 Hordeum-SxM-base-4H 78.1 Hordeum-SxM-FeedQTL-4H 76.6 Hordeum-SxM-SSAP-4H 62 Hv-Consensus2006-Marcel-4H 64.1 Hv-Integrated2009-4H 74.6
	[ Show Nearby Loci ]
QTL with Locus Marker	QAa.StMo-4H.2 QBgsg.StMo-4H QSpsm.TyVo-4H QTw.TyVo-4H
Map Data	Barley consensus [ Show all 16 ]
Probe	WG464
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of WG464 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	WG464A WG464B Xcnl.WG464 Xwg464
Probe	WG464
Locus	WG464B WG464A WG464 Xcnl.WG464 Xwg464
Type	Genomic STS
PCR primers	AGTCCAAATGATGTCACAGG AGGACTGTGAAGATGCTACT
Linkage Group	[b 4L]
Insert Enzyme	PstI
Source Species	Triticum aestivum
Insert Size	1.4