Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WG940

[Submit comment/correction]

Locus	WG940
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	Barley-consensus-2003-3H 73.6 [ Show all 9 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QKp.BlE2-3H
Map Data	[ Hide all but 1 of 9 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, BinMap 2005 Barley, Consensus 2006, DArT Barley, Consensus 2023, FHB Barley, CxH Barley, CxS Barley, GxH
Probe	WG940
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	Number of populations contributing to the placement of WG940 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	WG940BS Xcnl.WG940 XWG940 Xwg940-3
Probe	WG940
Locus	Xwg940-3 WG940 Xcnl.WG940 XWG940 WG940BS
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	GCATTGCAATACAGTGAGTC GCACACACAAACGACGACGG
Sequence	WG940
Linkage Group	[b 3L] 3
Insert Enzyme	PstI
Source Species	Triticum aestivum
Insert Size	1